Progress Report
Printing and PDF Files
- Use the print button above to document your progress and review questions.
- Some browsers support printing to PDF files. Select the "Save as PDF" option (wording may vary) from your browser's print dialog box and select a location to save it to your computer. You may then email and/or print the saved PDF file.
- On an iPad or other iOS device, you can save the PDF to Google Drive or other platform. Once the PDF preview is shown, pinch-out to display it full screen, then press the share icon. Sharing options will appear and you can select Dropbox, Mail, Save to Files, Copy to Drive, etc.
Notebook
Partitioning by Space
Section Not Completed.
Partitioning by Space
Partitioning by Time
Section Not Completed.
Partitioning by Time
Partitioning by Food
Section Not Completed.
Partitioning by Food
Module 1 Conclusion
Section Not Completed.
Module 1 Conclusion
Module 2 Conclusion
Section Not Completed.
Module 2 Conclusion
Data Collection
Data from 73 Locations
Section Not Completed.
Data from 73 Locations
Species Name | Longitude | Latitude | Time | Time Category | Food |
---|---|---|---|---|---|
Buffalo | 36° 53' 34" | 0° 21' 12" | 6:15am | morning | grass |
Buffalo | 36° 53' 18" | 0° 21' 19" | 4:45am | night | grass |
Buffalo | 36° 52' 24" | 0° 23' 5" | 8:35am | morning | browse |
Buffalo | 36° 53' 57" | 0° 17' 34" | 9:12pm | night | grass |
Buffalo | 36° 52' 31" | 0° 19' 7" | 8:58pm | night | grass |
Buffalo | 36° 54' 38" | 0° 20' 25" | 9:18am | morning | grass |
Buffalo | 36° 54' 20" | 0° 25' 23" | 5:32pm | evening | browse |
Buffalo | 36° 54' 51" | 0° 20' 40" | 8:41pm | night | grass |
* Buffalo | 36° 54' 48" | 0° 24' 34" | 5:44pm | evening | grass |
Buffalo | 36° 55' 24" | 0° 21' 17" | 8:12pm | night | browse |
Buffalo | 36° 49' 24" | 0° 29' 30" | 4:32am | night | browse |
Buffalo | 36° 55' 24" | 0° 21' 17" | 9:42am | morning | grass |
Buffalo | 36° 52' 25" | 0° 18' 0" | 11:37pm | night | browse |
Buffalo | 36° 52' 52" | 0° 17' 47" | 5:16pm | evening | grass |
Buffalo | 36° 54' 30" | 0° 24' 12" | 11:04pm | night | browse |
Zebra | 36° 52' 46" | 0° 18' 29" | 9:08pm | night | grass |
Zebra | 36° 52' 47" | 0° 18' 27" | 6:12am | morning | grass |
Zebra | 36° 53' 56" | 0° 17' 59" | 9:31am | morning | grass |
Zebra | 36° 52' 49" | 0° 18' 24" | 6:48am | morning | grass |
Zebra | 36° 55' 30" | 0° 22' 34" | 8:31pm | night | grass |
Zebra | 36° 53' 45" | 0° 17' 22" | 6:56pm | evening | browse |
Zebra | 36° 53' 23" | 0° 21' 9" | 6:41pm | evening | grass |
Zebra | 36° 51' 33" | 0° 26' 29" | 7:52pm | evening | grass |
Zebra | 36° 55' 42" | 0° 22' 22" | 6:10pm | evening | grass |
Zebra | 36° 53' 16" | 0° 18' 44" | 7:15am | morning | grass |
Zebra | 36° 51' 33" | 0° 26' 39" | 7:41pm | evening | grass |
* Zebra | 36° 53' 1" | 0° 21' 19" | 7:23am | morning | grass |
Zebra | 36° 51' 39" | 0° 26' 25" | 7:11pm | evening | grass |
Zebra | 36° 54' 32" | 0° 20' 30" | 5:34am | morning | grass |
Zebra | 36° 51' 35" | 0° 26' 23" | 6:56pm | evening | grass |
Zebra | 36° 53' 0" | 0° 18' 23" | 6:12pm | evening | grass |
Zebra | 36° 54' 6" | 0° 20' 44" | 5:47am | morning | browse |
Zebra | 36° 53' 39" | 0° 21' 29" | 5:04pm | evening | grass |
Zebra | 36° 55' 26" | 0° 22' 36" | 4:31pm | evening | grass |
Zebra | 36° 53' 31" | 0° 16' 53" | 4:30pm | evening | grass |
Dik-dik | 36° 54' 36" | 0° 20' 15" | 4:11pm | evening | browse |
Dik-dik | 36° 53' 14" | 0° 16' 51" | 4:08pm | evening | grass |
Dik-dik | 36° 53' 25" | 0° 17' 21" | 8:12pm | night | browse |
Dik-dik | 36° 55' 1" | 0° 23' 50" | 8:37am | morning | browse |
Dik-dik | 36° 54' 8" | 0° 22' 5" | 5:18pm | evening | browse |
Dik-dik | 36° 53' 30" | 0° 17' 28" | 8:48am | morning | browse |
Dik-dik | 36° 53' 2" | 0° 17' 44" | 5:56pm | evening | browse |
Dik-dik | 36° 52' 3" | 0° 27' 16" | 8:41am | morning | browse |
* Dik-dik | 36° 51' 58" | 0° 25' 44" | 9:23am | morning | browse |
Dik-dik | 36° 52' 15" | 0° 25' 2" | 5:42pm | evening | browse |
Dik-dik | 36° 55' 38" | 0° 22' 23" | 8:51pm | night | browse |
Dik-dik | 36° 53' 53" | 0° 24' 32" | 8:30am | morning | browse |
Dik-dik | 36° 55' 24" | 0° 21' 34" | 5:57pm | evening | browse |
Dik-dik | 36° 54' 39" | 0° 24' 48" | 9:43am | morning | browse |
Dik-dik | 36° 51' 34" | 0° 28' 44" | 9:18am | morning | browse |
Dik-dik | 36° 52' 6" | 0° 28' 33" | 9:01pm | night | browse |
Dik-dik | 36° 51' 33" | 0° 27' 41" | 5:12pm | evening | browse |
Dik-dik | 36° 51' 21" | 0° 29' 37" | 5:01am | morning | browse |
Dik-dik | 36° 53' 44" | 0° 18' 6" | 5:34am | morning | browse |
Dik-dik | 36° 54' 33" | 0° 24' 12" | 6:12am | morning | browse |
Impala | 36° 53' 33" | 0° 21' 12" | 4:02pm | evening | browse |
Impala | 36° 52' 29" | 0° 21' 43" | 9:45am | morning | browse |
Impala | 36° 55' 1" | 0° 22' 29" | 4:19pm | evening | grass |
Impala | 36° 53' 30" | 0° 17' 28" | 8:12pm | night | browse |
Impala | 36° 54' 1" | 0° 20' 29" | 9:21am | morning | browse |
Impala | 36° 51' 7" | 0° 26' 5" | 4:22pm | evening | browse |
Impala | 36° 51' 53" | 0° 25' 57" | 8:12am | morning | grass |
Impala | 36° 54' 44" | 0° 24' 10" | 7:32am | morning | browse |
Impala | 36° 54' 1" | 0° 20' 29" | 8:37pm | night | browse |
Impala | 36° 54' 42" | 0° 24' 8" | 7:01am | morning | grass |
Impala | 36° 52' 51" | 0° 18' 29" | 5:23pm | evening | browse |
Impala | 36° 53' 28" | 0° 17' 22" | 6:56am | morning | browse |
Impala | 36° 54' 8" | 0° 25' 34" | 5:27pm | evening | browse |
* Impala | 36° 51' 34" | 0° 28' 44" | 7:17pm | evening | browse |
Impala | 36° 54' 1" | 0° 20' 29" | 6:03am | morning | grass |
Impala | 36° 51' 48" | 0° 24' 1" | 6:31pm | evening | browse |
Impala | 36° 53' 17" | 0° 16' 49" | 6:04am | morning | grass |
Impala | 36° 52' 29" | 0° 21' 43" | 9:02pm | night | browse |
Foraging Time of Day
Section Not Completed.
Foraging Time of Day
Animal | Morning | Evening | Night | |||
---|---|---|---|---|---|---|
Dik-dik | 50% | (10) | 35% | (7) | 15% | (3) |
Zebra zebra | 35% | (7) | 55% | (11) | 10% | (2) |
Impala | 44% | (8) | 39% | (7) | 17% | (3) |
Buffalo | (4) | (3) | (8) |
Foraging Classification
Section Not Completed.
Foraging Classification
Animal | Grass | Browse | Classification | |||
---|---|---|---|---|---|---|
Dik-dik | 5% | (1) | 95% | (19) | browser | |
Zebra zebra | 90% | (18) | 10% | (2) | ||
Impala | 28% | (5) | 72% | (13) | ||
Buffalo | (9) | (6) |
Diet Profile Sequence Identification
Section Not Completed.
Diet Profile Sequence Identification
DNA Fragment 1 of 2
tag barcode sequence
5'five prime––Tag: C, C, T, A, T, A, G, CCCTATAGC––Barcode sequence: A, T, C, C, T, A, T, T, A, T, T, T, T, A, C, G, A, A, A, A, T, A, A, A, C, A, T, A, A, A, C, A, A, A, A, G, T, T, C, A, G, C, A, A, G, C, G, A, G, A, A, T, AATCCTATTATTTTACGAAAATAAACATAAACAAAAGTTCAGCAAGCGAGAATA––3'three prime
DNA Fragment 2 of 2
tag barcode sequence
5'five prime––Tag: G, G, T, C, T, A, C, AGGTCTACA––Barcode sequence: A, T, C, C, T, G, T, T, T, T, C, C, G, A, A, A, A, C, C, A, A, G, A, A, G, A, G, T, T, C, A, G, A, A, A, A, G, G, A, G, A, A, T, A, A, A, A, A, A, A, GATCCTGTTTTCCGAAAACCAAGAAGAGTTCAGAAAAGGAGAATAAAAAAAG––3'three prime
Animal Diets Venn Diagram
Section Not Completed.
Animal Diets Venn Diagram
Browse | Grasses | ||||||||||||||||||||||||||||||
Plant species
|
Acacia drepanolobium
|
Abutilon mauritianum
|
Melanthera scandens
|
Helichrysum glumaceum
|
Sphaeranthus suaveolens
|
Malva parviflora
|
Barleria ramulosa
|
Boscia angustifolia
|
Achyropsis avicularis
|
Solanum nigrum
|
Lippia javanica
|
Barleria spinisepala
|
Dychoristes radicans
|
Crassulaceae (family)
|
Senna gardneri
|
Aristida congesta
|
Chloris virgata
|
Eragrostis racemosa
|
Digitaria (genus)
|
Panicum maximum
|
Setaria sphacelata
|
Themeda triandra
|
Aristida kenyensis
|
Digitaria velutina
|
Garnotia (genus)
|
Echinochloa pyramidalis
|
Lintonia nutans
|
Leersia hexandra
|
Pennisetum sp.
|
Eragrostis sp.
|
Eragrostis superba
|
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Grevy's Zebra |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Dik-dik |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Cape Buffalo |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Impala |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Sorenson's Index Values
Section Not Completed.
Sorenson's Index Values
Grevy's Zebra | Cape Buffalo | Impala | Dik-dik | |
---|---|---|---|---|
Grevy's Zebra | ||||
Cape Buffalo | .42 | |||
Impala | .37 | |||
Dik-dik |
Test Your Knowledge
Module 1 Review
Section Not Completed.
Module 1 Review
1)
2)
3)
4)
Venn Diagram Review
Section Not Completed.
Venn Diagram Review
1)
2)
3)
Sorenson's Index Review
Section Not Completed.
Sorenson's Index Review
1)
2)
3)
Module 2 Review
Section Not Completed.
Module 2 Review
1)
2)
3)