Match the tag sequence to determine which sample it came from.
tag barcode sequence
5'five prime––Tag: G, G, T, C, T, A, C, AGGTCTACA––Barcode sequence: A, T, C, C, T, G, T, T, T, T, C, C, G, A, A, A, A, C, C, A, A, G, A, A, G, A, G, T, T, C, A, G, A, A, A, A, G, G, A, G, A, A, T, A, A, A, A, A, A, A, GATCCTGTTTTCCGAAAACCAAGAAGAGTTCAGAAAAGGAGAATAAAAAAAG––3'three prime
Please select the match to the tag sequence.
This dung sample came from a cape buffalo.